Stem-loop sequence cpo-mir-27b

AccessionMI0038584 (change log)
DescriptionCavia porcellus miR-27b stem-loop
Literature search

1 open access papers mention cpo-mir-27b
(3 sentences)

Stem-loop
   --            auug        ugau     
5'   agagcuuagcug    gugaacag    uggu 
     ||||||||||||    ||||||||    ||| u
3'   ucuugaaucggu    cacuuguu    gccu 
   cg            --ga        --uc     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562897.1: 4055574-4055636 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-27b
cpo-mir-23bDS562897.1: 4055809-4055868 [-]
cpo-mir-27bDS562897.1: 4055574-4055636 [-]
cpo-mir-24-1DS562897.1: 4055099-4055157 [-]
Database links

Mature sequence cpo-miR-27b-5p

Accession MIMAT0046892
Sequence

1 - 

agagcuuagcugauuggugaaca

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-27b-3p

Accession MIMAT0046893
Sequence

43 - 

uucacaguggcuaaguucugc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).