Stem-loop sequence cpo-mir-27a

AccessionMI0038583 (change log)
DescriptionCavia porcellus miR-27a stem-loop
Literature search

1 open access papers mention cpo-mir-27a
(3 sentences)

Stem-loop
   --a         ug  u       g g  cc 
5'    gggcuuagc  cu gugagca g uu  c
      |||||||||  || ||||||| | ||   
3'    cuugaaucg  ga cacuugu c ga  a
   ugc         gu  -       g g  cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562897.1: 12931848-12931908 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-27a
cpo-mir-23aDS562897.1: 12931646-12931704 [+]
cpo-mir-27aDS562897.1: 12931848-12931908 [+]
cpo-mir-24-2DS562897.1: 12931984-12932043 [+]
Database links

Mature sequence cpo-miR-27a-5p

Accession MIMAT0046890
Sequence

1 - 

agggcuuagcugcuugugagca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-27a-3p

Accession MIMAT0046891
Sequence

41 - 

uucacaguggcuaaguuccgu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).