Stem-loop sequence cpo-mir-26b

AccessionMI0038582 (change log)
DescriptionCavia porcellus miR-26b stem-loop
Stem-loop
   --u         uc           u ug 
5'    ucaaguaau  aggauagguug g  c
      |||||||||  ||||||||||| |   
3'    gguucauua  ucuuguccgac c  u
   cuc         cc           - ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563008.1: 48442-48498 [-]
intergenic
Database links

Mature sequence cpo-miR-26b-5p

Accession MIMAT0046888
Sequence

1 - 

uucaaguaauucaggauagguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-26b-3p

Accession MIMAT0046889
Sequence

36 - 

ccuguucuccauuacuuggcuc

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).