Stem-loop sequence cpo-mir-26a-1

AccessionMI0038580 (change log)
DescriptionCavia porcellus miR-26a-1 stem-loop
Stem-loop
   --uu         c          -  gca g 
5'     caaguaauc aggauaggcu gu   g u
       ||||||||| |||||||||| ||   |  
3'     guucauugg ucuuauccgg ca   c c
   gcac         u          g  --a c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562871.1: 36503835-36503895 [-]
intergenic
Database links

Mature sequence cpo-miR-26a-5p

Accession MIMAT0046885
Sequence

1 - 

uucaaguaauccaggauaggcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-26a-3p

Accession MIMAT0046886
Sequence

40 - 

ccuauucuugguuacuugcacg

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).