Stem-loop sequence cpo-mir-24-1

AccessionMI0038577 (change log)
DescriptionCavia porcellus miR-24-1 stem-loop
Literature search

1 open access papers mention cpo-mir-24-1
(12 sentences)

Stem-loop
   --  g   a         ua     ucucu 
5'   gu ccu cugagcuga  ucagu     u
     || ||| |||||||||  |||||      
3'   ca gga gacuugacu  gguca     g
   ga  a   c         -c     cacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562897.1: 4055099-4055157 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-24-1
cpo-mir-23bDS562897.1: 4055809-4055868 [-]
cpo-mir-27bDS562897.1: 4055574-4055636 [-]
cpo-mir-24-1DS562897.1: 4055099-4055157 [-]
Database links

Mature sequence cpo-miR-24-5p

Accession MIMAT0046880
Sequence

1 - 

gugccuacugagcugauaucagu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-24-3p

Accession MIMAT0046881
Sequence

38 - 

uggcucaguucagcaggaacag

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).