Stem-loop sequence cpo-mir-23b

AccessionMI0038576 (change log)
DescriptionCavia porcellus miR-23b stem-loop
Stem-loop
   --  --          -  c      gugacu 
5'   gg  guuccuggca ug ugauuu      u
     ||  |||||||||| || ||||||       
3'   cc  uagggaccgu ac acuaaa      a
   ca  au          u  -      auuaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562897.1: 4055809-4055868 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-23b
cpo-mir-23bDS562897.1: 4055809-4055868 [-]
cpo-mir-27bDS562897.1: 4055574-4055636 [-]
cpo-mir-24-1DS562897.1: 4055099-4055157 [-]
Database links

Mature sequence cpo-miR-23b-5p

Accession MIMAT0046878
Sequence

1 - 

ggguuccuggcaugcugauuu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-23b-3p

Accession MIMAT0046879
Sequence

38 - 

aucacauugccagggauuaccac

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).