Stem-loop sequence cpo-mir-23a

AccessionMI0038575 (change log)
DescriptionCavia porcellus miR-23a stem-loop
Stem-loop
   --- gg        g    g      c  u 
5'    g  guuccugg gaug gauuug ug c
      |  |||||||| |||| |||||| || u
3'    c  uagggacc uuac cuaaac ac g
   aac uu        g    a      -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562897.1: 12931646-12931704 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-23a
cpo-mir-23aDS562897.1: 12931646-12931704 [+]
cpo-mir-27aDS562897.1: 12931848-12931908 [+]
cpo-mir-24-2DS562897.1: 12931984-12932043 [+]
Database links

Mature sequence cpo-miR-23a-5p

Accession MIMAT0046876
Sequence

1 - 

gggguuccuggggaugggauuu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-23a-3p

Accession MIMAT0046877
Sequence

37 - 

aucacauugccagggauuuccaa

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).