Stem-loop sequence cpo-mir-21

AccessionMI0038573 (change log)
DescriptionCavia porcellus miR-21 stem-loop
Stem-loop
   --         a     a     a    u a 
5'   uagcuuauc gacug uguug cugu g a
     ||||||||| ||||| ||||| |||| | u
3'   gucggguag cugac acaac ggua c c
   cu         -     g     -    - u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562887.1: 7682937-7682996 [+]
intergenic
Database links

Mature sequence cpo-miR-21-5p

Accession MIMAT0046872
Sequence

1 - 

uagcuuaucagacugauguugacu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-21-3p

Accession MIMAT0046873
Sequence

39 - 

caacagcagucgaugggcuguc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).