Stem-loop sequence cpo-mir-20b

AccessionMI0038572 (change log)
DescriptionCavia porcellus miR-20b stem-loop
Stem-loop
        -ca           g     g   uuuu gc 
5' aguac   aagugcucaua ugcag uag    g  a
   |||||   ||||||||||| ||||| |||    |   
3' ucaug   uucacgggugu auguc auc    c  u
        acc           g     -   ---u au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562983.1: 2512676-2512744 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-20b
cpo-mir-106aDS562983.1: 2513060-2513118 [-]
cpo-mir-18bDS562983.1: 2512897-2512961 [-]
cpo-mir-20bDS562983.1: 2512676-2512744 [-]
cpo-mir-19b-2DS562983.1: 2512548-2512615 [-]
cpo-mir-92a-2DS562983.1: 2512411-2512471 [-]
cpo-mir-363DS562983.1: 2512251-2512315 [-]
Database links

Mature sequence cpo-miR-20b-5p

Accession MIMAT0046870
Sequence

6 - 

caaagugcucauagugcagguagu

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-20b-3p

Accession MIMAT0046871
Sequence

43 - 

uacuguagugugggcacuuccag

 - 65

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).