Stem-loop sequence cpo-mir-20a

AccessionMI0038571 (change log)
DescriptionCavia porcellus miR-20a stem-loop
Stem-loop
       c   -a                 g   -  uu 
5' guag acu  aagugcuuauagugcag uag ug  c
   |||| |||  ||||||||||||||||| ||| ||   
3' cguc uga  uucacgaguauuacguc auc au  a
       a   aa                 -   u  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562860.1: 32028964-32029034 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-20a
cpo-mir-17DS562860.1: 32029419-32029477 [-]
cpo-mir-18aDS562860.1: 32029271-32029335 [-]
cpo-mir-19aDS562860.1: 32029133-32029190 [-]
cpo-mir-20aDS562860.1: 32028964-32029034 [-]
cpo-mir-19b-1DS562860.1: 32028817-32028877 [-]
cpo-mir-92a-1DS562860.1: 32028701-32028759 [-]
Database links

Mature sequence cpo-miR-20a-5p

Accession MIMAT0046868
Sequence

8 - 

uaaagugcuuauagugcagguag

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-20a-3p

Accession MIMAT0046869
Sequence

44 - 

acugcauuaugagcacuuaaagu

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).