Stem-loop sequence cpo-mir-19a

AccessionMI0038568 (change log)
DescriptionCavia porcellus miR-19a stem-loop
Stem-loop
   --            --      ---    ag 
5'   aguuuugcauag  uugcac   uaca  a
     ||||||||||||  ||||||   ||||  a
3'   ucaaaacguauc  aacgug   augu  g
   ag            ua      uug    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562860.1: 32029133-32029190 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-19a
cpo-mir-17DS562860.1: 32029419-32029477 [-]
cpo-mir-18aDS562860.1: 32029271-32029335 [-]
cpo-mir-19aDS562860.1: 32029133-32029190 [-]
cpo-mir-20aDS562860.1: 32028964-32029034 [-]
cpo-mir-19b-1DS562860.1: 32028817-32028877 [-]
cpo-mir-92a-1DS562860.1: 32028701-32028759 [-]
Database links

Mature sequence cpo-miR-19a-5p

Accession MIMAT0046863
Sequence

1 - 

aguuuugcauaguugcacuac

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-19a-3p

Accession MIMAT0046864
Sequence

36 - 

ugugcaaaucuaugcaaaacuga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).