Stem-loop sequence cpo-mir-18b

AccessionMI0038567 (change log)
DescriptionCavia porcellus miR-18b stem-loop
Stem-loop
   ----u    u    c   u     ua  --g     
5'      aagg gcau uag gcagu  gu   aagc 
        |||| |||| ||| |||||  ||   ||| a
3'      uucc cgua auc cguca  ua   uucg 
   cgguc    c    a   c     uc  aga     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562983.1: 2512897-2512961 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-18b
cpo-mir-106aDS562983.1: 2513060-2513118 [-]
cpo-mir-18bDS562983.1: 2512897-2512961 [-]
cpo-mir-20bDS562983.1: 2512676-2512744 [-]
cpo-mir-19b-2DS562983.1: 2512548-2512615 [-]
cpo-mir-92a-2DS562983.1: 2512411-2512471 [-]
cpo-mir-363DS562983.1: 2512251-2512315 [-]
Database links

Mature sequence cpo-miR-18b-5p

Accession MIMAT0046861
Sequence

1 - 

uaaggugcaucuagugcaguuag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-18b-3p

Accession MIMAT0046862
Sequence

44 - 

ugcccuaaaugccccuucuggc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).