Stem-loop sequence cpo-mir-18a

AccessionMI0038566 (change log)
DescriptionCavia porcellus miR-18a stem-loop
Stem-loop
   ----u    u   uc   u    a   -  aa u 
5'      aagg gca  uag gcag uag ug  g a
        |||| |||  ||| |||| ||| ||  | g
3'      uucc cgu  auc cguc auc ac  u a
   cgguc    u   ga   c    -   u  ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562860.1: 32029271-32029335 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-18a
cpo-mir-17DS562860.1: 32029419-32029477 [-]
cpo-mir-18aDS562860.1: 32029271-32029335 [-]
cpo-mir-19aDS562860.1: 32029133-32029190 [-]
cpo-mir-20aDS562860.1: 32028964-32029034 [-]
cpo-mir-19b-1DS562860.1: 32028817-32028877 [-]
cpo-mir-92a-1DS562860.1: 32028701-32028759 [-]
Database links

Mature sequence cpo-miR-18a-5p

Accession MIMAT0046859
Sequence

1 - 

uaaggugcaucuagugcagauag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-18a-3p

Accession MIMAT0046860
Sequence

42 - 

acugcccuaagugcuccuucuggc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).