Stem-loop sequence cpo-mir-16b

AccessionMI0038564 (change log)
DescriptionCavia porcellus miR-16b stem-loop
Stem-loop
   --u         ua        c  ag   aau 
5'    agcagcacg  aauauugg gu  uga   a
      |||||||||  |||||||| ||  |||    
3'    ucgucgugu  uuauaacc ca  auu   a
   auu         ua        a  -a   aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562863.1: 57379204-57379268 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-16b
cpo-mir-15bDS562863.1: 57379064-57379123 [+]
cpo-mir-16bDS562863.1: 57379204-57379268 [+]
Database links

Mature sequence cpo-miR-16b-5p

Accession MIMAT0046855
Sequence

1 - 

uagcagcacguaaauauuggcgu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-16b-3p

Accession MIMAT0046856
Sequence

43 - 

accaauauuauugugcugcuuua

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).