Stem-loop sequence cpo-mir-16a

AccessionMI0038563 (change log)
DescriptionCavia porcellus miR-16a stem-loop
Stem-loop
   --         -  a        u u   gauu 
5'   uagcagcac gu aauauugg g uaa    c
     ||||||||| || |||||||| | |||     
3'   gucgucgug ca uuaugacc c auu    u
   aa         u  a        u u   aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562861.1: 59875390-59875454 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-16a
cpo-mir-15aDS562861.1: 59875526-59875593 [-]
cpo-mir-16aDS562861.1: 59875390-59875454 [-]
Database links

Mature sequence cpo-miR-16a-5p

Accession MIMAT0046853
Sequence

1 - 

uagcagcacguaaauauuggug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-16a-3p

Accession MIMAT0046854
Sequence

43 - 

ccaguauuaacugugcugcugaa

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).