Stem-loop sequence cpo-mir-15b

AccessionMI0038562 (change log)
DescriptionCavia porcellus miR-15b stem-loop
Stem-loop
   --u       c  c      ua   a guu 
5'    agcagca au augauu  cau c   a
      ||||||| || ||||||  ||| |   g
3'    ucgucgu ua uacuaa  gua g   u
   auc       a  u      gc   - aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562863.1: 57379064-57379123 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-15b
cpo-mir-15bDS562863.1: 57379064-57379123 [+]
cpo-mir-16bDS562863.1: 57379204-57379268 [+]
Database links

Mature sequence cpo-miR-15b-5p

Accession MIMAT0046851
Sequence

1 - 

uagcagcacaucaugauuuaca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-15b-3p

Accession MIMAT0046852
Sequence

39 - 

cgaaucauuauaugcugcucua

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).