Stem-loop sequence cpo-mir-15a

AccessionMI0038561 (change log)
DescriptionCavia porcellus miR-15a stem-loop
Stem-loop
   -----------ua        ua          ga  u 
5'              gcagcaca  augguuugug  uu u
                ||||||||  ||||||||||  || g
3'              cgucgugu  uaccggacgu  aa a
   aacauaaaaacuc        ua          gg  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562861.1: 59875526-59875593 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-15a
cpo-mir-15aDS562861.1: 59875526-59875593 [-]
cpo-mir-16aDS562861.1: 59875390-59875454 [-]
Database links

Mature sequence cpo-miR-15a-5p

Accession MIMAT0046849
Sequence

1 - 

uagcagcacauaaugguuugug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-15a-3p

Accession MIMAT0046850
Sequence

38 - 

caggccauauugugcugccuca

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).