Stem-loop sequence cpo-mir-10a

AccessionMI0038559 (change log)
DescriptionCavia porcellus miR-10a stem-loop
Stem-loop
   -uac   g     c          uaaggaa 
5'     ccu uaggu cgaauuugug       u
       ||| ||||| ||||||||||        
3'     ggg aucua gcuuaaacac       u
   auaa   g     u          ugguauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562908.1: 8675059-8675121 [+]
intergenic
Database links

Mature sequence cpo-miR-10a-5p

Accession MIMAT0046845
Sequence

1 - 

uacccuguagguccgaauuugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-10a-3p

Accession MIMAT0046846
Sequence

42 - 

caaauucguaucuaggggaaua

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).