Stem-loop sequence cpo-mir-7-1

AccessionMI0038553 (change log)
DescriptionCavia porcellus miR-7-1 stem-loop
Stem-loop
   --   a     a       u      --     a 
5'   ugg agacu gugauuu guuguu  uuuag u
     ||| ||||| ||||||| ||||||  |||||  
3'   acc ucuga cacuaaa caacag  aaauc a
   au   g     -       -      cu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562866.1: 17841616-17841679 [+]
intergenic
Database links

Mature sequence cpo-miR-7-5p

Accession MIMAT0046839
Sequence

1 - 

uggaagacuagugauuuuguuguu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-7-3p

Accession MIMAT0046840
Sequence

43 - 

caacaaaucacagucugccaua

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).