Stem-loop sequence cpo-let-7g

AccessionMI0038549 (change log)
DescriptionCavia porcellus let-7g stem-loop
Stem-loop
   --u        a            ugagg    aug     a 
5'    gagguagu guuuguacaguu     gucu   auacc c
      |||||||| ||||||||||||     ||||   |||||  
3'    uuccguca cggacaugucaa     uaga   uaugg c
   ccg        c            -----    gga     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562863.1: 27229787-27229865 [-]
intergenic
Database links

Mature sequence cpo-let-7g-5p

Accession MIMAT0046831
Sequence

1 - 

ugagguaguaguuuguacaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-let-7g-3p

Accession MIMAT0046832
Sequence

58 - 

cuguacaggccacugccuugcc

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).