Stem-loop sequence cpo-let-7f-1

AccessionMI0038547 (change log)
DescriptionCavia porcellus let-7f-1 stem-loop
Stem-loop
   ucaga ug                      ---------       u 
5'      g  agguaguagauuguauaguugu         gggguag g
        |  ||||||||||||||||||||||         ||||||| a
3'      c  uccguuaucuaacauaucaaua         ucccauu u
   ----c cu                      gaggauuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562897.1: 102055-102138 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-let-7f-1
cpo-let-7a-1DS562897.1: 101718-101790 [+]
cpo-let-7f-1DS562897.1: 102055-102138 [+]
cpo-let-7dDS562897.1: 104190-104265 [+]
Database links

Mature sequence cpo-let-7f-5p

Accession MIMAT0046828
Sequence

7 - 

ugagguaguagauuguauaguu

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-let-7f-3p

Accession MIMAT0046829
Sequence

63 - 

cuauacaaucuauugccuuccc

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).