Stem-loop sequence cpo-let-7c

AccessionMI0038544 (change log)
DescriptionCavia porcellus let-7c stem-loop
Stem-loop
   --u   g   u             ua  g ua a 
5'    gag uag agguuguaugguu  ga u  c c
      ||| ||| |||||||||||||  || |  | c
3'    uuc auc uccaacaugucaa  uu a  g c
   ccu   g   u             --  g gg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562889.1: 6524372-6524438 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-let-7c
cpo-mir-99aDS562889.1: 6525110-6525168 [-]
cpo-let-7cDS562889.1: 6524372-6524438 [-]
Database links

Mature sequence cpo-let-7c-5p

Accession MIMAT0046822
Sequence

1 - 

ugagguaguagguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-let-7c-3p

Accession MIMAT0046823
Sequence

46 - 

cuguacaaccuucuagcuuucc

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).