Stem-loop sequence cpo-let-7b

AccessionMI0038543 (change log)
DescriptionCavia porcellus let-7b stem-loop
Stem-loop
   --u                     ----      ca   a 
5'    gagguaguagguugugugguu    uccggg  gug u
      |||||||||||||||||||||    ||||||  |||  
3'    uuccgucauccaacauaucaa    aggcuc  cgc g
   ccc                     uaga      cc   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563015.1: 1994145-1994220 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-let-7b
cpo-let-7a-3DS563015.1: 1994494-1994562 [-]
cpo-let-7bDS563015.1: 1994145-1994220 [-]
Database links

Mature sequence cpo-let-7b-5p

Accession MIMAT0046820
Sequence

1 - 

ugagguaguagguugugugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-let-7b-3p

Accession MIMAT0046821
Sequence

55 - 

cuauacaaccuacugccuuccc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).