Stem-loop sequence cpo-let-7a-2

AccessionMI0038541 (change log)
DescriptionCavia porcellus let-7a-2 stem-loop
Stem-loop
   --u   g   u             uagaa ua a 
5'    gag uag agguuguauaguu     u  c u
      ||| ||| |||||||||||||     |  | c
3'    uuc auc uccgacaugucaa     a  g a
   ccu   g   c             --uag gg a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562874.1: 26138016-26138082 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-let-7a-2
cpo-mir-100DS562874.1: 26131486-26131542 [+]
cpo-let-7a-2DS562874.1: 26138016-26138082 [+]
Database links

Mature sequence cpo-let-7a-5p

Accession MIMAT0046817
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-let-7a-2-3p

Accession MIMAT0046819
Sequence

46 - 

cuguacagccuccuagcuuucc

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).