Stem-loop sequence bta-mir-2285dm

AccessionMI0038484 (change log)
DescriptionBos taurus miR-2285dm stem-loop
Literature search

11 open access papers mention bta-mir-2285dm
(15 sentences)

Stem-loop
   --         -   c  ua            a 
5'   uuggccaaa agu ug  uuuuucauaccg c
     ||||||||| ||| ||  |||||||||||| u
3'   aaccgguuu uca ac  aaaaaguauggu u
   cc         c   a  uc            a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 95331175-95331240 [-]
intergenic
Database links

Mature sequence bta-miR-2285dm

Accession MIMAT0046758
Sequence

1 - 

uuggccaaaagucuguauuuu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).