Stem-loop sequence bta-mir-2285dl-1

AccessionMI0038482 (change log)
DescriptionBos taurus miR-2285dl-1 stem-loop
Literature search

11 open access papers mention bta-mir-2285dl-1
(15 sentences)

Stem-loop
   --                  ------uu      
5'   aaagaguucauucagguu        ccaua 
     ||||||||||||||||||        |||| a
3'   uuuuucaaguaaguccaa        gguag 
   gg                  uaacacau      
Get sequence
Deep sequencing
4581 reads, 33.3 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 33968801-33968859 [-]
intergenic
Database links

Mature sequence bta-miR-2285dl-3p

Accession MIMAT0046756
Sequence

38 - 

auaaccugaaugaacuuuuugg

 - 59

Get sequence
Deep sequencing9065 reads, 73 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).