Stem-loop sequence bta-mir-1949

AccessionMI0038481 (change log)
DescriptionBos taurus miR-1949 stem-loop
Literature search

1 open access papers mention bta-mir-1949
(2 sentences)

Stem-loop
   --   -             gcc     c   c ua 
5'   cug guuggcauucugg   ugguu aug c  c
     ||| |||||||||||||   ||||| ||| |   
3'   gau cgaccguaggacc   aucaa uau g  u
   uu   a             -au     u   u uc 
Get sequence
Deep sequencing
25 reads, 5 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 52406413-52406480 [+]
intergenic
Database links

Mature sequence bta-miR-1949

Accession MIMAT0046755
Sequence

46 - 

uauaccaggaugccagcauaguu

 - 68

Get sequence
Deep sequencing22 reads, 17 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).