Stem-loop sequence bta-mir-2285dk

AccessionMI0038475 (change log)
DescriptionBos taurus miR-2285dk stem-loop
Literature search

11 open access papers mention bta-mir-2285dk
(15 sentences)

Stem-loop
   ---------aaaa   ug  ug        c   cc 
5'              guu  uu  gguuuuuc aua  a
                |||  ||  |||||||| |||   
3'              caa  aa  ccaaaaag uau  u
   ucaaccgguuuua   gu  gu        -   uc 
Get sequence
Deep sequencing
5318 reads, 37.5 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 47296014-47296077 [-]
intergenic
Database links

Mature sequence bta-miR-2285dk

Accession MIMAT0046749
Sequence

41 - 

ccugaaugaacauuuuggccaacu

 - 64

Get sequence
Deep sequencing4953 reads, 73 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).