Stem-loop sequence bta-mir-2285dj

AccessionMI0038473 (change log)
DescriptionBos taurus miR-2285dj stem-loop
Literature search

11 open access papers mention bta-mir-2285dj
(15 sentences)

Stem-loop
   --           ca     guc    a a 
5'   gaaaguuuguu  gguuu   ccca g u
     |||||||||||  |||||   |||| |  
3'   uuuucaaacaa  ccaaa   gggu c g
   gu           ac     --a    a u 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 10496152-10496209 [-]
intergenic
Database links

Mature sequence bta-miR-2285dj

Accession MIMAT0046747
Sequence

1 - 

gaaaguuuguucagguuuguccc

 - 23

Get sequence
Deep sequencing10 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).