Stem-loop sequence bta-mir-2285di

AccessionMI0038472 (change log)
DescriptionBos taurus miR-2285di stem-loop
Literature search

11 open access papers mention bta-mir-2285di
(15 sentences)

Stem-loop
   --             ug  uu        ug 
5'   caagauguucuuu  gg  uuucugua  a
     |||||||||||||  ||  ||||||||   
3'   guuuuacaaggaa  cc  aaagguau  u
   ug             gu  -c        ug 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 47670638-47670698 [+]
intergenic
Database links

Mature sequence bta-miR-2285di

Accession MIMAT0046746
Sequence

39 - 

aaacccugaaggaacauuuuggu

 - 61

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).