Stem-loop sequence bta-mir-2285dh

AccessionMI0038471 (change log)
DescriptionBos taurus miR-2285dh stem-loop
Literature search

11 open access papers mention bta-mir-2285dh
(15 sentences)

Stem-loop
   --          c     cu     uauaa 
5'   aaaaaguucg uuggg  uuucc     c
     |||||||||| |||||  |||||     a
3'   uuuuucaagu aaccc  gaagg     u
   gg          a     ag     uagac 
Get sequence
Deep sequencing
345 reads, 0 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 18711798-18711858 [-]
intergenic
Database links

Mature sequence bta-miR-2285dh

Accession MIMAT0046745
Sequence

40 - 

aggacccaaaugaacuuuuugg

 - 61

Get sequence
Deep sequencing142 reads, 61 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).