Stem-loop sequence bta-mir-2285dg

AccessionMI0038462 (change log)
DescriptionBos taurus miR-2285dg stem-loop
Literature search

11 open access papers mention bta-mir-2285dg
(15 sentences)

Stem-loop
   -a               gg           a 
5'   aaaaguucauuuugg  uuuuuccauaa a
     |||||||||||||||  |||||||||||  
3'   uuuucaaguaaagcc  aaaaggguauu u
   gg               -a           a 
Get sequence
Deep sequencing
387 reads, 21.2 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr26: 35397231-35397292 [-]
intergenic
Database links

Mature sequence bta-miR-2285dg

Accession MIMAT0046736
Sequence

41 - 

aaaaaccgaaaugaacuuuugg

 - 62

Get sequence
Deep sequencing383 reads, 66 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).