Stem-loop sequence bta-mir-194b-2

AccessionMI0038456 (change log)
DescriptionBos taurus miR-194b-2 stem-loop
Literature search

5 open access papers mention bta-mir-194b-2
(10 sentences)

Stem-loop
   --          c   -c     c  g 
5'   uaacagcagc cca  uggaa ua a
     |||||||||| |||  ||||| ||  
3'   auugucguug ggu  accuu au g
   ac          a   ac     c  g 
Get sequence
Deep sequencing
14 reads, 8.33 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr29: 44018309-44018361 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-194b-2
bta-mir-192chr29: 44018495-44018600 [+]
bta-mir-194b-2chr29: 44018309-44018361 [-]
bta-mir-194-2chr29: 44018295-44018377 [+]
Database links

Mature sequence bta-miR-194b

Accession MIMAT0046730
Sequence

34 - 

cacauggaguugcuguuaca

 - 53

Get sequence
Deep sequencing14 reads, 12 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).