Stem-loop sequence bta-mir-2285df

AccessionMI0038455 (change log)
DescriptionBos taurus miR-2285df stem-loop
Literature search

11 open access papers mention bta-mir-2285df
(15 sentences)

Stem-loop
   --auu    ca  ug        c    c 
5'      gguu  uu  gguuuuuc auaa a
        ||||  ||  |||||||| ||||  
3'      ucag  aa  ccaaaaag uauu u
   gguuu    ac  gu        -    c 
Get sequence
Deep sequencing
84 reads, 4 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 43281524-43281580 [+]
intergenic
Database links

Mature sequence bta-miR-2285df

Accession MIMAT0046729
Sequence

36 - 

aaaaaccugaacagacuuuugg

 - 57

Get sequence
Deep sequencing82 reads, 24 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).