Stem-loop sequence bta-mir-2285de

AccessionMI0038438 (change log)
DescriptionBos taurus miR-2285de stem-loop
Literature search

11 open access papers mention bta-mir-2285de
(15 sentences)

Stem-loop
   -        u  ca             g 
5'  aaaaguuc uu  gguuuuucuauaa a
    |||||||| ||  |||||||||||||  
3'  uuuucaag aa  ccaaagagguauu u
   u        u  ac             a 
Get sequence
Deep sequencing
477 reads, 18.3 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 63245391-63245447 [+]
intergenic
Database links

Mature sequence bta-miR-2285de

Accession MIMAT0046713
Sequence

1 - 

aaaaguucuuucagguuuuucu

 - 22

Get sequence
Deep sequencing459 reads, 71 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).