Stem-loop sequence bta-mir-2285dd

AccessionMI0038437 (change log)
DescriptionBos taurus miR-2285dd stem-loop
Literature search

11 open access papers mention bta-mir-2285dd
(15 sentences)

Stem-loop
   --caaau      ug        uguaa 
5'        uucguu  gguuuuuc     g
          ||||||  ||||||||     g
3'        aaguaa  ccaaaagg     u
   auuuuuc      gu        uguuu 
Get sequence
Deep sequencing
4572 reads, 38.4 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 142513005-142513061 [+]
intergenic
Database links

Mature sequence bta-miR-2285dd

Accession MIMAT0046712
Sequence

36 - 

gaaaaccugaaugaacuuuuua

 - 57

Get sequence
Deep sequencing4555 reads, 73 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).