Stem-loop sequence bta-mir-2285dc

AccessionMI0038435 (change log)
DescriptionBos taurus miR-2285dc stem-loop
Literature search

11 open access papers mention bta-mir-2285dc
(15 sentences)

Stem-loop
   ---        a             ca   g 
5'    aaaaaguu guuuagguuuuuc  uaa a
      |||||||| |||||||||||||  |||  
3'    uuuuucaa caaguucaaaagg  auu u
   cgg        a             ac   g 
Get sequence
Deep sequencing
347 reads, 4.41 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 70492051-70492111 [-]
intergenic
Database links

Mature sequence bta-miR-2285dc

Accession MIMAT0046710
Sequence

1 - 

aaaaaguuaguuuagguuuuuc

 - 22

Get sequence
Deep sequencing88 reads, 41 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).