Stem-loop sequence bta-mir-2285db

AccessionMI0038434 (change log)
DescriptionBos taurus miR-2285db stem-loop
Literature search

11 open access papers mention bta-mir-2285db
(15 sentences)

Stem-loop
   -       c   ca a           c 
5'  aaaaguu guu  g uuuuucuguaa a
    ||||||| |||  | |||||||||||  
3'  uuuucaa caa  c aaaaagguauu u
   u       a   ac c           c 
Get sequence
Deep sequencing
512 reads, 18.1 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 63371182-63371238 [+]
intergenic
Database links

Mature sequence bta-miR-2285db

Accession MIMAT0046709
Sequence

1 - 

aaaaguucguucagauuuuucu

 - 22

Get sequence
Deep sequencing485 reads, 72 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).