Stem-loop sequence bta-mir-2285da

AccessionMI0038432 (change log)
DescriptionBos taurus miR-2285da stem-loop
Literature search

11 open access papers mention bta-mir-2285da
(15 sentences)

Stem-loop
   c          cua         -   cg 
5'  aaaaaguucg   ggguuuuuc aua  a
    ||||||||||   ||||||||| |||   
3'  uuuuucaagu   uccaaaagg uau  u
   u          aag         g   ua 
Get sequence
Deep sequencing
4957 reads, 38.4 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 60435957-60436015 [-]
intergenic
Database links

Mature sequence bta-miR-2285da

Accession MIMAT0046707
Sequence

38 - 

gaaaaccugaaugaacuuuuuu

 - 59

Get sequence
Deep sequencing4557 reads, 73 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).