Stem-loop sequence bta-mir-2285cz

AccessionMI0038431 (change log)
DescriptionBos taurus miR-2285cz stem-loop
Literature search

11 open access papers mention bta-mir-2285cz
(15 sentences)

Stem-loop
   --         u         u  --u u 
5'   aaaaaguuc uuuggguuu uc   c a
     ||||||||| ||||||||| ||   |  
3'   uuuuuuaag aagcccaaa ag   g a
   ug         u         c  uau c 
Get sequence
Deep sequencing
6213 reads, 25 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 54937929-54937984 [+]
intergenic
Database links

Mature sequence bta-miR-2285cz

Accession MIMAT0046706
Sequence

35 - 

caaacccgaaugaauuuuuugu

 - 56

Get sequence
Deep sequencing9 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).