Stem-loop sequence bta-mir-2285cy

AccessionMI0038430 (change log)
DescriptionBos taurus miR-2285cy stem-loop
Literature search

11 open access papers mention bta-mir-2285cy
(15 sentences)

Stem-loop
   --c            g      ccc   aga 
5'    aaagguucauuu gguuuu   cua   u
      |||||||||||| ||||||   |||    
3'    uuuucaaguaag ccaaaa   gau   g
   guu            a      --a   auu 
Get sequence
Deep sequencing
5386 reads, 151 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 45101290-45101349 [-]
intergenic
Database links

Mature sequence bta-miR-2285cy

Accession MIMAT0046705
Sequence

39 - 

aaaaccagaaugaacuuuuuug

 - 60

Get sequence
Deep sequencing5350 reads, 77 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).