Stem-loop sequence bta-mir-2285cw-1

AccessionMI0038427 (change log)
DescriptionBos taurus miR-2285cw-1 stem-loop
Literature search

11 open access papers mention bta-mir-2285cw-1
(15 sentences)

Stem-loop
   ---       a   ca          uaa 
5'    aaaaguu guu  gguuuuucua   c
      ||||||| |||  ||||||||||    
3'    uuuucaa cag  ccaaaaagau   a
   ggu       a   ac          ucu 
Get sequence
Deep sequencing
466 reads, 22.5 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 67434839-67434895 [+]
intergenic
Database links

Mature sequence bta-miR-2285cw

Accession MIMAT0046702
Sequence

1 - 

aaaaguuaguucagguuuuucu

 - 22

Get sequence
Deep sequencing933 reads, 72 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).