Stem-loop sequence bta-mir-2285cv-2

AccessionMI0038425 (change log)
DescriptionBos taurus miR-2285cv-2 stem-loop
Literature search

11 open access papers mention bta-mir-2285cv-2
(15 sentences)

Stem-loop
   --au                 u    aau 
5'     aaguucauuuggauuuu ccau   a
       ||||||||||||||||| ||||    
3'     uucaaguaaaccuaaaa ggug   u
   uuuu                 -    gug 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 55045312-55045368 [-]
intergenic
Database links

Mature sequence bta-miR-2285cv

Accession MIMAT0046699
Sequence

36 - 

gaaaauccaaaugaacuuuuuu

 - 57

Get sequence
Deep sequencing14 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).