Stem-loop sequence bta-mir-2285ct

AccessionMI0038420 (change log)
DescriptionBos taurus miR-2285ct stem-loop
Literature search

11 open access papers mention bta-mir-2285ct
(15 sentences)

Stem-loop
   ---       a   ug a          cc 
5'    gaaaguu guu  g uuuuucuaua  c
      ||||||| |||  | ||||||||||   
3'    uuuucaa caa  c aaaaagguau  u
   ggu       c   gu c          uc 
Get sequence
Deep sequencing
3609 reads, 11.9 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 798474-798532 [-]
intergenic
Database links

Mature sequence bta-miR-2285ct

Accession MIMAT0046695
Sequence

1 - 

gaaaguuaguuuggauuuuucu

 - 22

Get sequence
Deep sequencing99 reads, 46 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).