Stem-loop sequence bta-mir-2285cs

AccessionMI0038418 (change log)
DescriptionBos taurus miR-2285cs stem-loop
Literature search

11 open access papers mention bta-mir-2285cs
(15 sentences)

Stem-loop
   ---       ug     au      c   c 
5'    aaaaguu  uucgg  uuuucc uaa a
      |||||||  |||||  |||||| |||  
3'    uuuucaa  aaguc  aaaagg auu c
   agu       gu     cc      u   c 
Get sequence
Deep sequencing
4459 reads, 27.8 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 63379731-63379789 [+]
intergenic
Database links

Mature sequence bta-miR-2285cs

Accession MIMAT0046693
Sequence

37 - 

aaaacccugaaugaacuuuuuga

 - 59

Get sequence
Deep sequencing4398 reads, 72 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).