Stem-loop sequence bta-mir-2285cr-2

AccessionMI0038417 (change log)
DescriptionBos taurus miR-2285cr-2 stem-loop
Literature search

11 open access papers mention bta-mir-2285cr-2
(15 sentences)

Stem-loop
           g   ag    c  a    g 
5' aaaaguuc uuc  guuu uc guag a
   |||||||| |||  |||| || ||||  
3' uuuucaag aag  caaa ag uauu u
           a   aa    a  g    g 
Get sequence
Deep sequencing
5722 reads, 37.8 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 106263814-106263869 [+]
intergenic
Database links

Mature sequence bta-miR-2285cr

Accession MIMAT0046691
Sequence

1 - 

aaaaguucguucagguuucu

 - 20

Get sequence
Deep sequencing11435 reads, 74 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).