Stem-loop sequence bta-mir-2285cq

AccessionMI0038413 (change log)
DescriptionBos taurus miR-2285cq stem-loop
Literature search

11 open access papers mention bta-mir-2285cq
(15 sentences)

Stem-loop
   ---       ug               cac 
5'    aaaaguu  uuccaguuuuucuau   a
      |||||||  |||||||||||||||    
3'    uuuucaa  aaggucaaaaaggua   u
   ggu       gu               uuc 
Get sequence
Deep sequencing
2731 reads, 135 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 76905742-76905800 [+]
intergenic
Database links

Mature sequence bta-miR-2285cq

Accession MIMAT0046688
Sequence

1 - 

aaaaguuuguuccaguuuuucu

 - 22

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).