Stem-loop sequence bta-mir-2285co

AccessionMI0038411 (change log)
DescriptionBos taurus miR-2285co stem-loop
Literature search

11 open access papers mention bta-mir-2285co
(15 sentences)

Stem-loop
   ---aaa    ug     a      ug   c 
5'       aguu  uucgg uuuuuc  uaa a
         ||||  ||||| ||||||  |||  
3'       ucaa  aaguc aaaaag  guu u
   gguuuc    gu     c      gu   u 
Get sequence
Deep sequencing
7392 reads, 40.3 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 24963097-24963155 [-]
intergenic
Database links

Mature sequence bta-miR-2285co

Accession MIMAT0046686
Sequence

38 - 

aaaaccugaaugaacucuuugg

 - 59

Get sequence
Deep sequencing7329 reads, 73 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).