Stem-loop sequence bta-mir-2285cn

AccessionMI0038408 (change log)
DescriptionBos taurus miR-2285cn stem-loop
Literature search

11 open access papers mention bta-mir-2285cn
(15 sentences)

Stem-loop
   ---        ug gca  u          g 
5'    aagaaguu  u   gg uuuucuguaa a
      ||||||||  |   || ||||||||||  
3'    uucuucaa  a   cc aaaagauauu u
   ggu        gu -aa  c          g 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 61733839-61733898 [-]
intergenic
Database links

Mature sequence bta-miR-2285cn

Accession MIMAT0046683
Sequence

39 - 

aaacccaaaugaacuucuuugg

 - 60

Get sequence
Deep sequencing28 reads, 14 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).