Stem-loop sequence bta-mir-2285cm

AccessionMI0038407 (change log)
DescriptionBos taurus miR-2285cm stem-loop
Literature search

11 open access papers mention bta-mir-2285cm
(15 sentences)

Stem-loop
   --             ug        c   a 
5'   uaaaaaguuuguu  gguuuuuc aua c
     |||||||||||||  |||||||| ||| a
3'   guuuuucaaacaa  ccaaaaag uau g
   ag             gu        a   c 
Get sequence
Deep sequencing
16436 reads, 66.7 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 34131583-34131643 [-]
intergenic
Database links

Mature sequence bta-miR-2285cm

Accession MIMAT0046682
Sequence

39 - 

aaaaccugaacaaacuuuuugga

 - 61

Get sequence
Deep sequencing4922 reads, 73 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).